yclE

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yclE
168

similar to prolyl aminopeptidase

locus
BSU_03660
Molecular weight
32.56 kDa
pI
5.62
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yclE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0596

This gene is a member of the following regulons

Gene
Coordinates
415,350  416,195
The protein
Protein family
[wiki|AB hydrolase superfamily] (according to UniProt)
[wiki|Domains]
[wiki|AB hydrolase-1 domain] (aa 30-268) (according to UniProt)
Structure
[PDB|1QTR] (from Serratia marcescens, 23% identity) [pubmed|10467172]
[AF|P94407]
Expression and Regulation
Operons
genes
[gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]
description
[pubmed|22383849]
Open in new tab

[gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]

2022-04-08 08:12:13

Jstuelk

4

41823e6281b4c1b3d383d68d43048aecda261115

2C31C95F719031DCCD8F66F5215E28D64A790DF3

Biological materials
Mutant
MGNA-C063 (yclE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2061 NBRP B. subtilis, Japan]
BKE03660 ([gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACGCCCCCTTTT,  downstream forward: _UP4_TAAAAAACAGCCCGCAGATC
BKK03660 ([gene|955CEAE1FBBABFD683FABB60CF74554AF12019B2|yclE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTCACGCCCCCTTTT,  downstream forward: _UP4_TAAAAAACAGCCCGCAGATC
References
Research papers
10467172

955CEAE1FBBABFD683FABB60CF74554AF12019B2

Page visits: 960

Time of last update: 2022-05-26 09:13:37

Author of last update: Melvin.boenninger