yfkD

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yfkD
168

unknown

locus
BSU_07930
Molecular weight
29.44 kDa
pI
10.16
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfkD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5916

This gene is a member of the following regulons

Gene
Coordinates
866,331  867,125
The protein
Structure
[AF|O34579]
Expression and Regulation
Operons
genes
[gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]-[gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]
description
[Pubmed|19543710]
regulation
expressed in the forespore ([protein|search|SigG]) [Pubmed|19543710]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|19543710], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]→[gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]

2022-04-27 14:27:17

ghost

15

3293de75246b3b12dd0f70da7ab134626009404e

9FFB7CEECEF3BD6C0841D30C7C31076D086FB20F

Biological materials
Mutant
MGNA-C270 (yfkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2268 NBRP B. subtilis, Japan]
BKE07930 ([gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCACTCTTTCTATGGC,  downstream forward: _UP4_TAAATAAAAAACTGATTCCA
BKK07930 ([gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07930 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCACTCTTTCTATGGC,  downstream forward: _UP4_TAAATAAAAAACTGATTCCA
References
19543710

95B85312D4647B94AF04B912F818AB8345CCDCFD

Page visits: 1017

Time of last update: 2022-05-19 06:45:30

Author of last update: Bzhu