yaaI

yaaI
168

general stress protein, similar to isochorismatase

locus
BSU_00170
Molecular weight
20.66 kDa
pI
4.67
Protein length
Gene length
function
survival of ethanol stress
product
unknown
essential
no
synonyms
yaaI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1335

This gene is a member of the following regulons

Gene
Coordinates
25,221  25,766
The protein
Protein family
[wiki|Isochorismatase family] (according to UniProt)
Structure
[PDB|3TG2] (from Vibrio cholerae, 26% identity) [pubmed|22993087]
[AF|P37532]
Additional information
important for survival of ethanol stress [Pubmed|15805528]
Expression and Regulation
Operons
genes
[gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]-[gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]
description
[pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]->[gene|77BEC74867422AA225A1F12AD63464656DBDCBE8|yaaH]

2022-11-27 23:57:55

Bzhu

38

7c59ed067cd9702eeafbb90cc255468664f43fed

92E7FFF049039C116E6130CE3D2C724CE041EF9E

Biological materials
Mutant
MGNA-B890 (yaaI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1889 NBRP B. subtilis, Japan]
BKE00170 ([gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGACAGTCTCCTTTCC,  downstream forward: _UP4_TAAACATGATCAGCGCTTTT
BKK00170 ([gene|95C78F511C49E04241D31593E6837BDFF48D6E14|yaaI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00170 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGACAGTCTCCTTTCC,  downstream forward: _UP4_TAAACATGATCAGCGCTTTT
References
15805528,15805528,22993087

95C78F511C49E04241D31593E6837BDFF48D6E14

Page visits: 1724

Time of last update: 2022-11-29 13:49:10

Author of last update: Jstuelk