thiS

thiS
168

sulfur carrier protein, hydroxyethylthiazole phosphate biosynthesis

locus
BSU_11680
Molecular weight
7.49 kDa
pI
5.5
Protein length
Gene length
function
biosynthesis of thiamine
product
sulfur carrier protein
essential
no
ec
null
synonyms
thiS, yjbS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2104

This gene is a member of the following regulons

Gene
Coordinates
1,244,844  1,245,044
The protein
Protein family
sulfur carrier protein ThiS family (single member, according to UniProt)
Structure
[PDB|1TYG] (complex with [protein|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]) [Pubmed|15362849]
[AF|O31617]
Expression and Regulation
Operons
genes
[gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]-[gene|CA6AAE8AC5B5EF01A911B035F8782579CD876C08|tenI]-[gene|87B5C84B7EE10F60B545CCFEF6A527A546B80432|thiO]-[gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]-[gene|B58B8F260E446E28BC2E3A9AA84EA771EC0A8634|thiG]-[gene|CCD3DDE9E52FCD4906735059CF30593BEB56FD1B|thiF]-[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]
description
[Pubmed|1898926]
regulation
repressed by thiamine ([wiki|Thi-box]) [Pubmed|16356850]
the [wiki|Thi-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [wiki|RNA switch], via [wiki|RNA switch], in [regulon|protein:E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
Open in new tab

[gene|47E47FB7D9C079DF603906694C4649A049814346|tenA]→[gene|97EDB4ACD64C5FA2E6014ED133DF18F602FF58BB|thiD]

2022-11-24 21:30:20

Jstuelk

28

a48634f4963321f6f5f59c5107f472325227a1b0

A1FEA45B91FD65F137EB4D1A0FCD88BC91331EAF

Biological materials
Mutant
BKE11680 ([gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTCTTTACCGTTCAGCTGTA,  downstream forward: _UP4_ATTGTCCATTTTGTAGGAGG
BKK11680 ([gene|95DA3F899037140F48B99E065C768356CE08FA94|thiS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_GTCTTTACCGTTCAGCTGTA,  downstream forward: _UP4_ATTGTCCATTTTGTAGGAGG
References
Reviews
19348578,10382260
Original Publications
15362849,14567704

95DA3F899037140F48B99E065C768356CE08FA94

Page visits: 1014

Time of last update: 2022-11-29 06:12:17

Author of last update: Melvin.boenninger