yonT

yonT
168

toxin

locus
BSU_21000
Molecular weight
6.78 kDa
pI
12.86
Protein length
Gene length
function
unknown
product
toxin
essential
no
synonyms
yonT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,219,784  2,219,960
RNA
additional information
[gene|search|yonT ]mRNA half-life: 8 min [pubmed|29414903]
The protein
Structure
[AF|O31941]
Expression and Regulation
Operons
genes
[gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]-[gene|A01986F131F973AFE08CC28E89CB70FD2BED06EE|yoyJ]-[gene|21DF0BF609522F9FFF636A9AF99779A459166A8D|yonU]-[gene|ED02B21A2296C6A5A19007810D0416FCBAF5B9ED|yonV]
description
[Pubmed|29414903]
Open in new tab

[gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]→[gene|ED02B21A2296C6A5A19007810D0416FCBAF5B9ED|yonV]

2022-11-17 02:22:20

Jstuelk

19

d661e4643deb959e344fc55780c9cf0fdf5deda3

7E1852A1D0BC5DE07B624CDBA6A526EAC0DE6100

genes
[gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]
description
[pubmed|22383849]
regulatory mechanism
[protein|8832F99BF927D5A4D6CB265DB24D3AE46434A5CD|SR6]: antisense RNA, in [regulon|protein:8832F99BF927D5A4D6CB265DB24D3AE46434A5CD|SR6 regulon]
Open in new tab

[gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]

2022-11-20 20:56:03

Bzhu

20

0113ed565f75c2bf9706b925a7daabd80218e48d

D6112B5E4856688882A94BC48E268856375EB317

Biological materials
Mutant
BKE21000 ([gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTATGTACACCTCCTTTC,  downstream forward: _UP4_TGAGAGCTAAGCTAAAGGGG
BKK21000 ([gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTATGTACACCTCCTTTC,  downstream forward: _UP4_TGAGAGCTAAGCTAAAGGGG
References
Reviews
23300472,31075979,32850966
Original Publications
20156992,19210617,23300471,29414903

961DB64225CEF84D80982ADBDC9BBBCDF5049132

Page visits: 1296

Time of last update: 2022-11-30 11:02:33

Author of last update: Jstuelk