spoVB

spoVB
168

MurJ family lipid II flippase, spore cortex peptidoglycan synthesis

locus
BSU_27670
Molecular weight
55.91 kDa
pI
10.19
Protein length
Gene length
function
spore cortex peptidoglycan synthesis
product
sporulation-specific MurJ family lipid II flippase
essential
no
synonyms
spoVB, spoIIIF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5841

This gene is a member of the following regulons

Gene
Coordinates
2,829,564  2,831,120
The protein
Protein family
[wiki|Polysaccharide synthase family] (according to UniProt)
[wiki|MOP exporter family]
Structure
[AF|Q00758]
Paralogous protein(s)
[protein|D6B1837075ECBEE1FEAC704DDB6795336092897F|yabM], [protein|0AFFB4B715CCE6B1C53BBB7F890EFB3126CB466E|murJ], [protein|34A5CD28A3DBCB10B4E1C82E50143FA73B553919|ykvU]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|9633C40190B7D0EA264270FD44567C61A012AD15|spoVB]-[gene|C52461A2FE856C94E0D0701FB7412368404FC83B|yrzE]
description
[pubmed|22383849]
regulation
expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE], [wiki|SpoIIID]) [Pubmed|1744050,15383836]
regulatory mechanism
[protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]: repression, [pubmed|15383836], in [regulon|protein:90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [pubmed|1744050], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|9633C40190B7D0EA264270FD44567C61A012AD15|spoVB]→[gene|C52461A2FE856C94E0D0701FB7412368404FC83B|yrzE]

2023-01-21 22:57:15

Jstuelk

27

3d9cf008322b4a86befb1b7390b388e393ab9266

EBC3D6455890919A760BCEF30508470C1A334950

Biological materials
Mutant
BKE27670 ([gene|9633C40190B7D0EA264270FD44567C61A012AD15|spoVB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCCCCTGCCTTC,  downstream forward: _UP4_GGACGGTTGATCATCCGATA
BKK27670 ([gene|9633C40190B7D0EA264270FD44567C61A012AD15|spoVB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTACCCCCTGCCTTC,  downstream forward: _UP4_GGACGGTTGATCATCCGATA
References
Reviews
35638784
Original Publications
19648239,19666716,1744050,15383836,25918422

9633C40190B7D0EA264270FD44567C61A012AD15

Page visits: 2723

Time of last update: 2023-02-03 22:03:52

Author of last update: Jstuelk