thiT
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

thiT
168

S protein of thiamine [wiki|ECF transporter]

locus
BSU_30990
Molecular weight
20.31 kDa
pI
10.24
Protein length
Gene length
function
thiamine uptake
product
S protein of thiamine [wiki|ECF transporter]
essential
no
synonyms
thiT, yuaJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3859

This gene is a member of the following regulons

Gene
Coordinates
3,179,306  3,179,884
The protein
Protein family
vitamin uptake transporter (VUT/ECF) (TC 2.A.88) family (with [protein|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP] and [protein|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP], according to UniProt)
Structure
[PDB|3RLB] (from ''Lactococcus lactis'', 32% identity) [Pubmed|21706007]
[AF|O32074]
[wiki|Localization]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT]
description
[pubmed|22383849]
regulation
repressed by thiamine ([regulon|Thi-box|]) [Pubmed|12376536]
regulatory mechanism
[protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: RNA switch, in [regulon|protein:E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
Open in new tab

[gene|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT]

2022-04-27 22:34:59

Bzhu

19

5648730ec35500745e5df475c207093ab6c90f2f

7B9163465013C5320491D0442F9D301075A059F4

Biological materials
Mutant
MGNA-A222 (yuaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/222 NBRP B. subtilis, Japan]
BKE30990 ([gene|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTATCTCCTTCCATT,  downstream forward: _UP4_TAAAAGTAACAATCCCCCAG
BKK30990 ([gene|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTATCTCCTTCCATT,  downstream forward: _UP4_TAAAAGTAACAATCCCCCAG
References
Reviews
20497229,22574898,24362466
Original Publications
16291685,21706007,18763711,12376536,23602660,20218726

9685A380F95F1A73A693B53E4D35A1CB51043FEC

Page visits: 2170

Time of last update: 2022-08-07 16:00:53

Author of last update: Jstuelk