pbuE
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

pbuE
168

putative hypoxanthine exporter

locus
BSU_05800
Molecular weight
41.38 kDa
pI
8.88
Protein length
Gene length
function
nucleotide metabolism
product
putative hypoxanthine exporter
essential
no
synonyms
pbuE, ydhL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
625,125  626,291
RNA
Structure
[PDB|5E54] [pubmed|27841871]
[PDB|5SWE] [pubmed|27841871]
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
DHA1 family (single member, according to UniProt)
Structure
[PDB|6KKL] (from E. coli, 25% identity) [pubmed|33280821]
[AF|Q797E3]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]
description
[pubmed|22383849]
regulation
induced by hypoxanthine and guanine, [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|purR]-independent [Pubmed|12923093]
induced by adenine ([regulon|A-box|]) [Pubmed|14718920]
regulatory mechanism
a-box: termination/antitermination, adenine-controlled, in [regulon|other_regulator:a-box|a-box]
Open in new tab

[gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]

2022-05-16 17:39:25

Jstuelk

17

4ad5cb3bc83bd54de6d82c141a796c9b794bb372

625C3B71A89269D217761F5815439949AB35D4AD

Biological materials
Mutant
MGNA-C187 (ydhL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2185 NBRP B. subtilis, Japan]
BKE05800 ([gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAAACTCCTTTACTT,  downstream forward: _UP4_TCCTTGTAAAAGGAGGATTT
BKK05800 ([gene|96B48D9B984010FECD2C194D7CF3CADFC22F2AA7|pbuE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAAACTCCTTTACTT,  downstream forward: _UP4_TCCTTGTAAAAGGAGGATTT
References
25550163,15629952,14718920,12923093,12923093,18441052,17935948,17853814,16931335,16201765,20022916,12787499,21283784,25573585,33259551,27841871,33280821,35622174

96B48D9B984010FECD2C194D7CF3CADFC22F2AA7

Page visits: 2995

Time of last update: 2022-08-08 23:05:46

Author of last update: Jstuelk