yusN

yusN
168

unknown

locus
BSU_32860
Molecular weight
13.00 kDa
pI
4.49
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yusN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,374,001  3,374,333
The protein
Structure
[AF|O32180]
Expression and Regulation
Operons
genes
[gene|39AB5A4DB00CE399724F40CF250A17CC7630F7AC|yuzM]-[gene|96E8845DF1E88263D124D1E4D36940A043DA9E74|yusN]
description
[pubmed|22383849]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|39AB5A4DB00CE399724F40CF250A17CC7630F7AC|yuzM]->[gene|96E8845DF1E88263D124D1E4D36940A043DA9E74|yusN]

2022-12-19 03:03:09

Bzhu

17

2bf6a23afce622bfa3c846da4a32e61815c80077

D10190046F9A4D5927D3EEFF2BA364D30FE427D6

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
MGNA-B594 (yusN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1593 NBRP B. subtilis, Japan]
BKE32860 ([gene|96E8845DF1E88263D124D1E4D36940A043DA9E74|yusN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGCTGATTCATTCTGGCGC,  downstream forward: _UP4_TAACAACATTAGTAAAAAGG
BKK32860 ([gene|96E8845DF1E88263D124D1E4D36940A043DA9E74|yusN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGCTGATTCATTCTGGCGC,  downstream forward: _UP4_TAACAACATTAGTAAAAAGG
References
16497325,30782632

96E8845DF1E88263D124D1E4D36940A043DA9E74

Page visits: 1116

Time of last update: 2023-02-04 21:21:51

Author of last update: Jstuelk