trpP
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

trpP
168

S protein of tryptophan [wiki|ECF transporter]

locus
BSU_10010
Molecular weight
18.13 kDa
pI
11.15
Protein length
Gene length
function
tryptophan uptake
product
S protein of tryptophan [wiki|ECF transporter]
essential
no
synonyms
trpP, yhaG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,074,646  1,075,164
The protein
Protein family
vitamin uptake transporter (VUT/ECF) (TC 2.A.88) family (with [protein|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT] and [protein|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP], according to UniProt)
Structure
[AF|O07515]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]
description
[Pubmed|10735881]
regulation
induced in the absence of tryptophan ([protein|search|MtrB]) [Pubmed|10735881]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10735881], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]

2022-07-10 16:57:06

ghost

19

8109cb480720fb24807dbe9aedbab0c3cf91e046

210562DF6F756E999F3EBC8F8A0D078F56396E7F

genes
[gene|E7ED2FB756B47A0F2C73E42E4168D16F20BD7B1B|serC]-[gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]
description
[Pubmed|22383849]
Open in new tab

[gene|E7ED2FB756B47A0F2C73E42E4168D16F20BD7B1B|serC]→[gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]

2022-07-20 02:34:26

Jstuelk

22

c99e716e8bf6b9fb2b00bd6aecb42a8104572307

2DB0D7DBF30D6A6589D8AD5F2E4104A7FDB6F538

Other regulations
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: translation inhibition, at an [wiki|RNA switch], the [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB] binding site overlaps the Shine-DAlgarno sequence and translation initation region, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB] binds in the presence of tryptophan [Pubmed|10735881]
Biological materials
Mutant
MGNA-A686 (yhaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/686 NBRP B. subtilis, Japan]
BKE10010 ([gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACTATGCTCTCCTCTG,  downstream forward: _UP4_TAATTGTCACACAAAACCTC
BKK10010 ([gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACTATGCTCTCCTCTG,  downstream forward: _UP4_TAATTGTCACACAAAACCTC
References
Reviews
20497229,22574898,24362466
Original Publications
10735881,14702295

97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3

Page visits: 2159

Time of last update: 2022-08-07 12:45:04

Author of last update: Melvin.boenninger