ypwA

ypwA
168

carboxypeptidase, metalloprotease

locus
BSU_22080
Molecular weight
58.01 kDa
pI
4.77
Protein length
Gene length
function
unknown
product
M32 carboxypeptidase
essential
no
ec
null
synonyms
ypwA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2317

This gene is a member of the following regulons

Gene
Coordinates
2,320,355  2,321,860
The protein
Catalyzed reaction/ biological activity
Release of a C-terminal amino acid with broad specificity, except for -Pro (according to UniProt)
Protein family
peptidase M32 family (single member, according to UniProt)
Structure
[PDB|3HQ2] [Pubmed|19544567]
[AF|P50848]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|9769C46DFFB6BD88E2224403F4EBC43351561A26|ypwA]
description
[Pubmed|22383849]
Open in new tab

[gene|9769C46DFFB6BD88E2224403F4EBC43351561A26|ypwA]

2022-12-19 10:07:08

Jstuelk

26

fd6785d001d4782e4c99ff62102ccb8edb1a4551

2E281F64CF931C565F77E8684443A9574B88B692

Biological materials
Mutant
MGNA-A892 (ypwA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/892 NBRP B. subtilis, Japan]
BKE22080 ([gene|9769C46DFFB6BD88E2224403F4EBC43351561A26|ypwA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCCTCCCTAT,  downstream forward: _UP4_TAATCAAAAGCCTGGCGGCG
BKK22080 ([gene|9769C46DFFB6BD88E2224403F4EBC43351561A26|ypwA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCCATTCCCTCCCTAT,  downstream forward: _UP4_TAATCAAAAGCCTGGCGGCG
References
Reviews
34410368
Original Publications
19544567

9769C46DFFB6BD88E2224403F4EBC43351561A26

Page visits: 1009

Time of last update: 2023-01-27 03:44:27

Author of last update: Jstuelk