
At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!


H+/Ca2+ exchanger

Molecular weight
37.37 kDa
Protein length
Gene length
calcium export
calcium export via proton antiporter
chaA, yfkE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0387

This gene is a member of the following regulons

865,205  866,260
The protein
Protein family
Ca(2+):cation antiporter (CaCA) (TC 2.A.19) family (single member, according to UniProt)
[PDB|4KJS] [Pubmed|23798403]
cell membrane [Pubmed|30602489,23798403]
Expression and Regulation
expressed in the forespore ([protein|search|SigG]) [Pubmed|19543710]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|19543710], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2022-04-27 14:27:17





Biological materials
MGNA-C269 (yfkE::erm), available at the [ NBRP B. subtilis, Japan]
BKE07920 ([gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT,  downstream forward: _UP4_TAACCTGAAAAAATGATGGA
BKK07920 ([gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT,  downstream forward: _UP4_TAACCTGAAAAAATGATGGA


Page visits: 2042

Time of last update: 2022-05-19 09:02:34

Author of last update: Jstuelk