SubtiWiki SubtiWiki
chaA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

chaA
168

H+/Ca2+ exchanger

locus
BSU_07920
Molecular weight
37.37 kDa
pI
5.21
Protein length
Gene length
function
calcium export
product
calcium export via proton antiporter
essential
no
synonyms
chaA, yfkE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0387

This gene is a member of the following regulons

Gene
Coordinates
865,205  866,260
The protein
Protein family
Ca(2+):cation antiporter (CaCA) (TC 2.A.19) family (single member, according to UniProt)
Structure
[PDB|4KJS] [Pubmed|23798403]
[wiki|Localization]
cell membrane [Pubmed|30602489,23798403]
Expression and Regulation
Operons
genes
[gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]-[gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]
description
[Pubmed|19543710]
regulation
expressed in the forespore ([protein|search|SigG]) [Pubmed|19543710]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|19543710], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]→[gene|95B85312D4647B94AF04B912F818AB8345CCDCFD|yfkD]

2021-10-23 09:42:21

ghost

7

3293de75246b3b12dd0f70da7ab134626009404e

9FFB7CEECEF3BD6C0841D30C7C31076D086FB20F

Biological materials
Mutant
MGNA-C269 (yfkE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2267 NBRP B. subtilis, Japan]
BKE07920 ([gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT,  downstream forward: _UP4_TAACCTGAAAAAATGATGGA
BKK07920 ([gene|977695DBD3FF4C823E1A46E06C46706254F80891|chaA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGTGAAATAGCTCCTTT,  downstream forward: _UP4_TAACCTGAAAAAATGATGGA
References
19543710,23798403,30602489,32341169

977695DBD3FF4C823E1A46E06C46706254F80891

Page visits: 1831

Time of last update: 2022-01-21 07:34:34

Author of last update: Jstuelk