spo0F

spo0F
168

phosphotransferase of the [wiki|sporulation] initiation [wiki|phosphorelay]

locus
BSU_37130
Molecular weight
14.09 kDa
pI
4.7
Protein length
Gene length
function
initiation of [wiki|sporulation]
product
phosphotransferase of the sporulation initiation phosphorelay
essential
no
synonyms
spo0F

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5803

This gene is a member of the following regulons

Gene
Coordinates
3,809,550  3,809,924
The protein
[wiki|Domains]
[wiki|Response regulatory domain] (aa 5-119) (according to UniProt)
Structure
[PDB|1SRR] (phosphatase resistant mutant)
[PDB|1F51] (complex with [protein|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B])
[PDB|2JVK] (Mutant L66A),
[PDB|2FSP]
[PDB|3Q15] ([protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]-[protein|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F] complex) [Pubmed|21346797]
[AF|P06628]
Modification
phosphorylated on an Asp residue by [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA], [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB], [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC], [protein|511E71BB1981758857854C8E9BF657287CE60C11|kinD], or [protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]
dephosphorylated by [protein|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA], [protein|E07E123CC9FB3B29DDA8EC58A33FEEE1DDFC4834|rapB], [protein|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE], or [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH] [Pubmed|17581123]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]
description
[Pubmed|2457578]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|8483422]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|8483422], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2457578], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|1569009], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]

2022-12-06 23:19:44

ghost

38

2ecefbc456a439cb858c3fe0f47a0a729c6d0c4d

5D41B0B30203DE9E8136B8C60D1561748FE160AB

Biological materials
Mutant
BKE37130 ([gene|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTACACCCCAATATTA,  downstream forward: _UP4_TGACAAAAAGAAGAAACAAA
BKK37130 ([gene|9896B99346B0D3F6D57F57377DB253B46135A37A|spo0F]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37130 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTACACCCCAATATTA,  downstream forward: _UP4_TGACAAAAAGAAGAAACAAA
References
Reviews
28886686,35638784
Original Publications
20413551,9299348,9335530,11923303,8608130,16788205,12067336,8497199,10094672,15299688,8643670,8805550,26165942,11069677,2997779,8483422,16333746,2118512,10997904,9601032,9254596,8730857,10411754,17350627,21346797,9341920,9843420,2509430,1846779,9540996,9477965,17581123,8483422,2457578,1569009,23490197,21346797,22267516,23524609,25598361,27501195,30125296,30212463,35012345

9896B99346B0D3F6D57F57377DB253B46135A37A

Page visits: 3707

Time of last update: 2022-12-07 03:48:25

Author of last update: Jstuelk