ycnK
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

ycnK
168

copper-responsive transcription repressor of the [gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI] operon, [wiki|DeoR family]

locus
BSU_03960
Molecular weight
21.29 kDa
pI
7.37
Protein length
Gene length
function
regulation of copper uptake
product
transcription repressor, [wiki|DeoR family]
essential
no
synonyms
ycnK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1349

This gene is a member of the following regulons

Gene
Coordinates
448,461  449,033
Phenotypes of a mutant
elevated expression of ''[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]'' under conditions of copper excess [Pubmed|19168619]
The protein
Catalyzed reaction/ biological activity
repression of ''[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]'' expression in the presence of excess copper [Pubmed|22904286,19168619]
Protein family
DeoR family of transcription factors
[wiki|Domains]
[wiki|HTH deoR-type domain] (aa 3-58) (according to UniProt)
[wiki|Cofactors]
copper acts as corepressor [Pubmed|19168619]
Structure
[AF|P94433]
Expression and Regulation
Operons
genes
[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]
description
[Pubmed|22904286,22383849]
regulation
induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
regulatory mechanism
[protein|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]: repression, [Pubmed|22904286,19168619], in [regulon|protein:98D807FBB847BF731B5C236557C8F70347279CE0|ycnK regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|15101989], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|22904286], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]→[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]

2022-06-27 04:22:04

ghost

17

8c53a82ab33b564f7e085488581f68629ff467ca

7BEB015AF7C4D6403B44178463BB2A5EFEF7821A

Biological materials
Mutant
MGNA-C017 (ycnK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2015 NBRP B. subtilis, Japan]
BKE03960 ([gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCATACACCCTCTTCAT,  downstream forward: _UP4_TAACACAACACATACAGCGG
BKK03960 ([gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCATACACCCTCTTCAT,  downstream forward: _UP4_TAACACAACACATACAGCGG
labs
[wiki|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
References
Reviews
22918892,25209494
Original Publications
19168619,22904286,22383849,15101989

98D807FBB847BF731B5C236557C8F70347279CE0

Page visits: 1592

Time of last update: 2022-08-08 00:30:59

Author of last update: Melvin.boenninger