mhqR

mhqR
168

[wiki|MarR family ]transcriptional repressor of [gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2], [gene|7334017333600B876030056BE9247AD4E8996A1D|mhqA], [gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]-[gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]and [gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]-[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|search|mhqP ]expression

locus
BSU_13670
Molecular weight
16.43 kDa
pI
6.42
Protein length
Gene length
function
regulation of resistance to quinones and diamide
product
[wiki|MarR family ]transcriptional repressor
essential
no
synonyms
mhqR, ykvE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
1,433,199  1,433,636
Phenotypes of a mutant
resistant to quinones and diamide
inactivation of ''mhqR'' predisposes cells to grow without a wall (due to protection from oxidative stress) [Pubmed|26051891]
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 5-137) (according to UniProt)
Structure
[PDB|3GFJ] (from Sulfolobus tokodaii, 26% identity) [pubmed|19509310]
[AF|O31672]
Paralogous protein(s)
[protein|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]
Additional information
Binding site: tATCTcgaAtTCgAGATaaaa [Pubmed|17725564]
information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000225 PRODORIC2 database]
Expression and Regulation
Operons
genes
[gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]
description
[Pubmed|22383849]
Open in new tab

[gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]

2022-06-10 18:15:34

ghost

12

1216743de6d486febda3418fb3b1da6275834b2c

6DF15A74CE435FAF05CE6FC4F5E2104ADE7DCA09

Biological materials
Mutant
BKE13670 ([gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT,  downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
BKK13670 ([gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT,  downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
labs
[wiki|Haike Antelmann],Free University of Berlin, Germany
References
18282125,26051891,17725564,22383849,27965289,19509310,34097790

997B828A99D6D8460712C18ED0CE566B285C22DC

Page visits: 1288

Time of last update: 2022-06-24 08:35:52

Author of last update: Jstuelk