mhqR

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

mhqR
168

[wiki|MarR family ]transcriptional repressor of [gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2], [gene|7334017333600B876030056BE9247AD4E8996A1D|mhqA], [gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]-[gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]and [gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]-[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|search|mhqP ]expression

locus
BSU_13670
Molecular weight
16.43 kDa
pI
6.42
Protein length
Gene length
function
regulation of resistance to quinones and diamide
product
[wiki|MarR family ]transcriptional repressor
essential
no
synonyms
mhqR, ykvE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
1,433,199  1,433,636
Phenotypes of a mutant
resistant to quinones and diamide
inactivation of ''mhqR'' predisposes cells to grow without a wall (due to protection from oxidative stress) [Pubmed|26051891]
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 5-137) (according to UniProt)
Structure
[PDB|3GFJ] (from Sulfolobus tokodaii, 26% identity) [pubmed|19509310]
[AF|O31672]
Paralogous protein(s)
[protein|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|ykoM]
Additional information
Binding site: tATCTcgaAtTCgAGATaaaa [Pubmed|17725564]
information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000225 PRODORIC2 database]
Expression and Regulation
Operons
genes
[gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]
description
[Pubmed|22383849]
Open in new tab

[gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]

2022-05-22 01:23:37

ghost

7

1216743de6d486febda3418fb3b1da6275834b2c

6DF15A74CE435FAF05CE6FC4F5E2104ADE7DCA09

Biological materials
Mutant
BKE13670 ([gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT,  downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
BKK13670 ([gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT,  downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
labs
[wiki|Haike Antelmann],Free University of Berlin, Germany
References
18282125,26051891,17725564,22383849,27965289,19509310,34097790

997B828A99D6D8460712C18ED0CE566B285C22DC

Page visits: 1240

Time of last update: 2022-05-25 04:39:07

Author of last update: Jstuelk