SubtiWiki SubtiWiki
ywdH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ywdH
168

similar to aldehyde dehydrogenase

locus
BSU_37960
Molecular weight
50.60 kDa
pI
9.62
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
1.2.1.3
synonyms
ywdH, ipa-58r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

Gene
Coordinates
3,896,290 → 3,897,660
The protein
Catalyzed reaction/ biological activity
aldehyde + H2O + NAD+ --> carboxylate + 2 H+ + NADH (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
Structure
[PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 28% identity, 62% similarity)
Paralogous protein(s)
[protein|A0BEB92D54799956A4ADE106A1388E5710141069|gabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]
Expression and Regulation
Operons
genes
[gene|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH]
description
[Pubmed|9353933]
Open in new tab

[gene|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH]

2022-01-24 05:04:42

ghost

3

b24a3913c3780ad5db66f59c4b3fdd6dc4439057

77A3C1D63D141D86865660EA984EA1718FB49845

Biological materials
Mutant
MGNA-A564 (ywdH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/564 NBRP B. subtilis, Japan]
BKE37960 (Δ[gene|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCGTTTCTCCTTTTTG,  downstream forward: _UP4_TAAAAAAGCGCAGATCACCT
BKK37960 (Δ[gene|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCGTTTCTCCTTTTTG,  downstream forward: _UP4_TAAAAAAGCGCAGATCACCT
References
9353933

99F1FAF28FB4817D94E84BD5288FA33124558933

Page visits: 1011

Time of last update: 2022-01-25 04:12:03

Author of last update: Melvin.boenninger