yxzF

yxzF
168

general stress protein

locus
BSU_38610
Molecular weight
5.78 kDa
pI
11.41
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yxzF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,964,091  3,964,249
The protein
Structure
[AF|O32283]
Expression and Regulation
Operons
genes
[gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]-[gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]
description
[Pubmed|8990303]
regulation
expressed late during [wiki|sporulation] in the forespore [wiki|SigG] [Pubmed|27698084]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|27698084], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]→[gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]

2023-02-02 14:09:59

ghost

29

2e8b672555f6a425e250bf03a974e94656637507

136A388E58BFB19B9852E8EAEF40166A3E0CCE89

Biological materials
Mutant
BKE38610 ([gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTGATTGCCTCTT,  downstream forward: _UP4_TGATCCCGGCTGTTTTTTTA
BKK38610 ([gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38610 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTGATTGCCTCTT,  downstream forward: _UP4_TGATCCCGGCTGTTTTTTTA
References
11544224,27698084

9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A

Page visits: 907

Time of last update: 2023-02-06 00:22:42

Author of last update: Bzhu