ykkE

ykkE
168

formyltetrahydrofolate deformylase

locus
BSU_13110
Molecular weight
34.34 kDa
pI
5.95
Protein length
Gene length
function
purine nucleotide synthesis
product
formyltetrahydrofolate deformylase
essential
no
ec
3.5.1.10
synonyms
ykkE, purU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0788

This gene is a member of the following regulons

Gene
Coordinates
1,377,243  1,378,145
The protein
Catalyzed reaction/ biological activity
(6S)-10-formyltetrahydrofolate + H2O --> (6S)-5,6,7,8-tetrahydrofolate + formate + H+ (according to UniProt)
Protein family
PurU family (single member, according to UniProt)
[wiki|Domains]
[wiki|ACT domain] (aa 21-102) (according to UniProt)
Structure
[PDB|3W7B] (from ''Thermus thermophilus'', 58% identity) [Pubmed|24108189]
[AF|O34990]
Paralogous protein(s)
[protein|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]
Expression and Regulation
Operons
genes
[gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]
description
[Pubmed|22383849]
Open in new tab

[gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]

2022-09-08 15:06:21

ghost

11

834e5a9df21949203b959e9d3a180ba892a2d22f

FCE88EF8CE5E05C009FE8080EE315AF3228F840C

Biological materials
Mutant
MGNA-B310 (ykkE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1309 NBRP B. subtilis, Japan]
BKE13110 ([gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC,  downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
BKK13110 ([gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC,  downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
References
24108189,22383849

9A399CAA672C3DF90531A7A7168916DE86EFA365

Page visits: 1206

Time of last update: 2022-10-03 05:04:33

Author of last update: Melvin.boenninger