

formyltetrahydrofolate deformylase

Molecular weight
34.34 kDa
Protein length
Gene length
purine nucleotide synthesis
formyltetrahydrofolate deformylase
ykkE, purU

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0788

This gene is a member of the following regulons

1,377,243  1,378,145
The protein
Catalyzed reaction/ biological activity
(6S)-10-formyltetrahydrofolate + H2O --> (6S)-5,6,7,8-tetrahydrofolate + formate + H+ (according to UniProt)
Protein family
PurU family (single member, according to UniProt)
[wiki|ACT domain] (aa 21-102) (according to UniProt)
[PDB|3W7B] (from ''Thermus thermophilus'', 58% identity) [Pubmed|24108189]
Paralogous protein(s)
Expression and Regulation
Open in new tab


2022-11-26 20:02:48





Biological materials
MGNA-B310 (ykkE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1309 NBRP B. subtilis, Japan]
BKE13110 ([gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC,  downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
BKK13110 ([gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13110 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC,  downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG


Page visits: 1249

Time of last update: 2022-12-06 05:19:50

Author of last update: Melvin.boenninger