yaaK

yaaK
168

similar to DNA-binding protein

locus
BSU_00200
Molecular weight
11.64 kDa
pI
4.54
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yaaK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0718

This gene is a member of the following regulons

Gene
Coordinates
28,529  28,852
The protein
Protein family
YbaB/EbfC family (single member, according to UniProt)
Structure
[PDB|1YBX] (from Clostridium thermocellum, 53% identity)
[AF|P24281]
[wiki|Localization]
nucleoid (according to UniProt)
Expression and Regulation
Operons
genes
[gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]-[gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]-[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]-[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]-[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
description
[Pubmed|22383849]
Open in new tab

[gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]→[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]

2022-11-22 14:39:55

Jstuelk

50

1a32cdecddaee24171f48459041fdcb062bafc36

7EC4B7D4D9D0E5E8848420FD5562059E4207233C

additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Mutant
MGNA-B892 (yaaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1891 NBRP B. subtilis, Japan]
BKE00200 ([gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCATTCACTCTCTTTC,  downstream forward: _UP4_TTATTCTAGGGGGATAAAAG
BKK00200 ([gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00200 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGCATTCACTCTCTTTC,  downstream forward: _UP4_TTATTCTAGGGGGATAAAAG
References
12884008,19594923

9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889

Page visits: 1337

Time of last update: 2022-11-26 22:40:46

Author of last update: Jstuelk