bmrD

bmrD
168

multidrug [wiki|ABC transporter ](ATP-binding protein), also involved in the signalling pathway to activate [protein|search|KinA ]at the onset of [wiki|sporulation]

locus
BSU_09720
Molecular weight
76.12 kDa
pI
7.08
Protein length
Gene length
function
multiple antibiotic resistance
product
multidrug [wiki|ABC transporter ](ATP-binding protein)
essential
no
synonyms
bmrD, yheH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1132

This gene is a member of the following regulons

Gene
Coordinates
1,047,072  1,049,093
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
[wiki|ABC transmembrane type-1 domain] (aa 18-398) (according to UniProt)
[wiki|ABC transporter domain] (aa 430-664) (according to UniProt)
Structure
[PDB|7M33] [pubmed|34931066]
[PDB|5MKK] (TmrAB complex from Thermus thermophilus, 38% identity) [pubmed|28069938]
[AF|O07549]
Paralogous protein(s)
[protein|0EB4D3E1B9AF39ECCBD79EB559FAE5BB0EE4C156|ygaD]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]-[gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]
description
[Pubmed|25217586]
regulation
''[protein|search|bmrB]-[protein|search|bmrC]-[protein|search|bmrD]'' expression only occurs during the late-exponential and stationary growth stages ([protein|search|AbrB]) [Pubmed|25217586]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675,25217586], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]: attenuation, [Pubmed|25217586], in [regulon|protein:E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB regulon]
Open in new tab

[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]→[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]

2022-11-28 19:38:36

ghost

45

d44db0ccfdaad593c84b5df727fd52fef8cbf908

6093E35E651F3CE8574990742E33F0A5554BD884

Biological materials
Mutant
MGNA-B491 (yheH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1490 NBRP B. subtilis, Japan]
BKE09720 ([gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTCCATAACGTTTTTCCTA,  downstream forward: _UP4_TAACGCTCAAAAACCCAAAA
BKK09720 ([gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTCCATAACGTTTTTCCTA,  downstream forward: _UP4_TAACGCTCAAAAACCCAAAA
References
Reviews
33450852
Original Publications
19167342,10092453,16487324,25217586,21602923,29507890,28069938,34931066

9B2766D2F8892AA17DB480216570C81C33355C3B

Page visits: 3137

Time of last update: 2022-12-01 12:53:19

Author of last update: Jstuelk