gdpP

gdpP
168

c-di-AMP specific phosphodiesterase

locus
BSU_40510
Molecular weight
74.14 kDa
pI
4.86
Protein length
Gene length
function
control of sporulation initiation, cell wall homeostasis
product
c-di-AMP phosphodiesterase
essential
no
synonyms
gdpP, yybT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3887

This gene is a member of the following regulons

Gene
Coordinates
4,163,643  4,165,622
Phenotypes of a mutant
inactivation of ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant acquires suppressor mutations in ''[gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]'' [Pubmed|26240071]
a ''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]'' double mutant is defective in [wiki|biofilm formation] [Pubmed|27252699]
altered morphology on MSgg medium [pubmed|29588402]
The protein
Catalyzed reaction/ biological activity
cyclic dinucleotide phosphodiesterase, hydrolysis of cyclic di-AMP [Pubmed|19901023]
3',3'-c-di-AMP + H2O --> 5'-O-phosphonoadenylyl-(3'→5')-adenosine + H+ (according to UniProt)
Protein family
GdpP/PdeA phosphodiesterase family (single member, according to UniProt)
[wiki|Domains]
two transmembrane domains at the N-terminus [Pubmed|19901023]
a domain that shares minimum sequence homology with Heme-binding [PAS domain|Per-ARNT-Sim (PAS) domains] (80 aa) [Pubmed|21257773]
degenerate [wiki|GGDEF domain] (aa 173 - 301) [Pubmed|19901023]
a [wiki|DHH-DHHA1 domain] [Pubmed|19901023]
Structure
[PDB|2M1C] (N-terminal PAS domain of GdpP from ''Geobacillus thermodenitrificans'') [Pubmed|23504327]
[AF|P37484]
Effectors of protein activity
ppGpp inhibits cyclic dinucleotide phosphodiesterase activity [Pubmed|19901023]
Heme binding suppresses phosphodiesterase activity [Pubmed|21257773]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]-[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]-[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]
description
[Pubmed|22383849]
additional information
term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''yybS'' [Pubmed|27120414]
there is an [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-dependent antisense RNA ([gene|0098E3A710385B31987947E6206A89000CA32F55|S1559]) to [gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP] [pubmed|22956758]
Open in new tab

[gene|6640C754249DD8E4E15889CC838F5D04A682BF58|yybS]→[gene|56737276B364EC0BC7391F1BA15F225C352ED905|rplI]

2022-12-02 01:32:33

Jstuelk

40

5C9AFECBF28951E728207E104CAD078590852270

8A05783D8D0BA185AE37B5649C8B5E3E55F05A22

Biological materials
Mutant
MGNA-B834 (yybT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1833 NBRP B. subtilis, Japan]
GP998 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc''), available in [wiki|Jörg Stülke]'s lab [Pubmed|23192352]
GP2040 (''[gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]''::''spc'' ''[gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH]''::''erm'' without terminator, available in [wiki|Jörg Stülke]'s lab) [Pubmed|26240071]
BKE40510 ([gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATCACTCCCCACC,  downstream forward: _UP4_AGATGAAGGTTATTTTCTTA
BKK40510 ([gene|9B624751E8BD3EA616B4B50633A558F4CE032E2C|gdpP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATCACTCCCCACC,  downstream forward: _UP4_AGATGAAGGTTATTTTCTTA
labs
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
25869574,26773214,30224435,32472931,32603625
Original Publications
19901023,21257773,21566650,23504327,22211522,22956758,25616256,26240071,27252699,29588402,18502872
GdpP homologs in other organisms
18502872

9B624751E8BD3EA616B4B50633A558F4CE032E2C

Page visits: 3529

Time of last update: 2022-12-02 19:15:51

Author of last update: TPed