SubtiWiki SubtiWiki
yetK

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yetK
168

unknown

locus
BSU_07210
Molecular weight
35.60 kDa
pI
9.53
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yetK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
788,636  789,628
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 38-163, 187-314) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]-[gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]
description
[Pubmed|22383849]
Open in new tab

[gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]→[gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]

2021-08-12 14:31:19

Jstuelk

2

911942fbf9df012a0314dcd95c4e17147ab04060

1057582342954597DE56B8C5640DD0FB285D6D53

genes
[gene|1F2E7B30C04E8C58DDC3583A9C912BD480E979F7|yezD]-[gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]-[gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]
description
[Pubmed|22383849]
Open in new tab

[gene|1F2E7B30C04E8C58DDC3583A9C912BD480E979F7|yezD]→[gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]

2021-09-13 22:44:58

Jstuelk

1

38bce3d9b15713beed8fea9dda4ca42b290717cb

7F937F73B2559A0B4F1A3BBBAF2ABEC68BDA6B93

Biological materials
Mutant
MGNA-B462 (yetK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1461 NBRP B. subtilis, Japan]
BKE07210 ([gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATCACTGCTCAA,  downstream forward: _UP4_TAGCCTGTCCGGATCGGACG
BKK07210 ([gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07210 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATCACTGCTCAA,  downstream forward: _UP4_TAGCCTGTCCGGATCGGACG

9B8857B4493AD36A2395372B00273244D291BBA7

Page visits: 843

Time of last update: 2021-12-15 15:59:48

Author of last update: Melvin.boenninger