yokJ

yokJ
168

antitoxin

locus
BSU_21570
Molecular weight
18.76 kDa
pI
4.13
Protein length
Gene length
function
inhibition of the cytotoxic activity of [protein|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]
product
antitoxin
essential
no
synonyms
yokJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,275,200  2,275,697
The protein
Structure
[AF|O31997]
Expression and Regulation
Operons
genes
[gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]-[gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]-[gene|8BA8DB1483190AB847F28F3E56C247FE85C3225E|yokK]-[gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
Open in new tab

[gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]→[gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]

2022-11-27 22:00:24

ghost

44

c0991145616d1ecd9ca254c77d6417772671b6cd

0031AF5FF8A7ECE1B60F8B6A925BF05711BF39E6

Biological materials
Mutant
BKE21570 ([gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAATGCTCAAGTCCG,  downstream forward: _UP4_TAATCTATTAAACAAAAGTA
BKK21570 ([gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCAATGCTCAAGTCCG,  downstream forward: _UP4_TAATCTATTAAACAAAAGTA
References
22200572,20817675,34280190

9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1

Page visits: 2019

Time of last update: 2022-11-28 03:57:27

Author of last update: Jstuelk