ybdN

ybdN
168

unknown

locus
BSU_02040
Molecular weight
31.35 kDa
pI
8.8
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybdN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
224,075  224,932
The protein
Structure
[AF|O31436]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]
regulation
repressed during logarithmic growth ([protein|search|AbrB]) [Pubmed|18840696]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]

2022-12-04 08:43:54

ghost

17

0758abf9519e2cc7709cf4e1d64cd4a1a66b6bcd

9286B7560C70D908A29FCB5A56EFD2C8A8D7B644

Biological materials
Mutant
MGNA-B959 (ybdN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1958 NBRP B. subtilis, Japan]
BKE02040 ([gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACAACCTCCTTTT,  downstream forward: _UP4_TAACTTATACCGAGCCGGTT
BKK02040 ([gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02040 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACAACCTCCTTTT,  downstream forward: _UP4_TAACTTATACCGAGCCGGTT
References
18957862,18840696,20709850

9C9F5F02DE6E08986072307EED78A931672AC642

Page visits: 1160

Time of last update: 2022-12-04 15:26:19

Author of last update: Bzhu