srfAD
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

srfAD
168

surfactin synthetase / competence

locus
BSU_03520
Molecular weight
27.47 kDa
pI
5.22
Protein length
Gene length
function
antibiotic synthesis
product
surfactin synthetase / competence
essential
no
synonyms
srfAD, comL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3208

This gene is a member of the following regulons

Gene
Coordinates
402,388 403,116
The protein
Protein family
thioesterase family (with [protein|27C362A132DDFF09E27FC919D0204D4C9E016803|yneP], according to UniProt)
Structure
[PDB|2RON] [pubmed|18704089]
[PDB|2K2Q]
[AF|Q08788]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]-[gene|3C484FDB3A440269E87D6B6E8500A875AC456666|srfAB]-[gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]-[gene|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|srfAC]-[gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]
description
[Pubmed|1715856]
regulation
expressed at high cell density ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051]
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|25666134], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8830686], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, [Pubmed|1715856,16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]: activation, [Pubmed|16166527], in [regulon|protein:00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR regulon]
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: repression, [Pubmed|12642660], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]: repression, [Pubmed|20817675], in [regulon|protein:5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1715856], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
A [protein|search|ncRNA] is predicted between '[protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|hxlR]' and '[protein|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]' [PubMed|20525796]
Open in new tab

[gene|81845F44CE2C601555066E31E87384FF5D7B4139|srfAA]→[gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]

2022-07-07 17:14:30

Jstuelk

37

620D29280C2CC5BBF61DFDE1E763667777B28513

4F5B391B1D8CC1181EDE8EB2DAC874A9B90A39CA

Biological materials
Mutant
BKE03520 ([gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGCTGTCTCCTCCTTT, downstream forward: _UP4_TGATCAAAAGCGGACAGCTT
BKK03520 ([gene|9D0914FC38FFF4028C2BA5970DC87B3A1027E253|srfAD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGGCTGTCTCCTCCTTT, downstream forward: _UP4_TGATCAAAAGCGGACAGCTT
References
Reviews
20735481
Original Publications
18704089,16166527,17227471,17190806,8830686,1715856,12642660,16091051,22511326,20817675,15378759

9D0914FC38FFF4028C2BA5970DC87B3A1027E253

Page visits: 2070

Time of last update: 2022-08-09 03:49:46

Author of last update: Melvin.boenninger