yokH

yokH
168

unknown

locus
BSU_21590
Molecular weight
21.39 kDa
pI
4.19
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yokH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

The protein
Structure
[AF|O31999]
Paralogous protein(s)
[protein|59FB4B286B814797FC2A3C0B42E1475364141A87|yobM]
Biological materials
Mutant
1A637 ( ''yokH''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A637&Search=1A637 BGSC]
BKE21590 ([gene|9D3C94ED5DF019669EE9BB0F9A5D5976C42BFEB3|yokH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAAATCACCCCATATT,  downstream forward: _UP4_TAGTGTGATGTATAAGACAG
BKK21590 ([gene|9D3C94ED5DF019669EE9BB0F9A5D5976C42BFEB3|yokH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATAAATCACCCCATATT,  downstream forward: _UP4_TAGTGTGATGTATAAGACAG

9D3C94ED5DF019669EE9BB0F9A5D5976C42BFEB3

Page visits: 3159

Time of last update: 2025-10-28 05:20:03

Author of last update: Melvin.boenninger