sspJ

sspJ
168

small acid-soluble spore protein (minor)

locus
BSU_33340
Molecular weight
5.03 kDa
pI
9.99
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor)
essential
no
synonyms
sspJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,421,465  3,421,605
The protein
Structure
[AF|Q7WY58]
[wiki|Localization]
spore core (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|9D436951B6E1F9D570D8F55B6AC2E6C1230EF805|sspJ]
description
[pubmed|22383849]
regulation
expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [Pubmed|16497325,9852018]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325,9852018], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|9D436951B6E1F9D570D8F55B6AC2E6C1230EF805|sspJ]

2022-12-17 23:13:35

Bzhu

16

41f942aed9b330d086d11c7b7bc7dcbd802c938a

920A85D9531D65BDA972C12B75EF1867C90B3C38

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE33340 ([gene|9D436951B6E1F9D570D8F55B6AC2E6C1230EF805|sspJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGTATCACCTCTTTTA,  downstream forward: _UP4_TAACCACATGCGGATAGGGC
BKK33340 ([gene|9D436951B6E1F9D570D8F55B6AC2E6C1230EF805|sspJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGTATCACCTCTTTTA,  downstream forward: _UP4_TAACCACATGCGGATAGGGC
References
9852018,16497325,30782632

9D436951B6E1F9D570D8F55B6AC2E6C1230EF805

Page visits: 885

Time of last update: 2023-02-05 16:48:38

Author of last update: Jstuelk