ybxB

ybxB
168

unknown

locus
BSU_01060
Molecular weight
22.37 kDa
pI
6.12
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ybxB, ybaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2813

This gene is a member of the following regulons

Gene
Coordinates
121,068  121,673
The protein
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
Structure
[PDB|1DUS] (from Methanococcus jannaschii, 43% identity) [pubmed|12836702]
[AF|P37872]
Expression and Regulation
additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
BKE01060 ([gene|9DA4AF1DBA4EA40F4E23B716EA81AC5B275BD7F5|ybxB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTAGAACCTCCTTTT,  downstream forward: _UP4_TGACTCGGTATTTTAACTAT
BKK01060 ([gene|9DA4AF1DBA4EA40F4E23B716EA81AC5B275BD7F5|ybxB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATTAGAACCTCCTTTT,  downstream forward: _UP4_TGACTCGGTATTTTAACTAT
References
7657605,26883633,12836702

9DA4AF1DBA4EA40F4E23B716EA81AC5B275BD7F5

Page visits: 1459

Time of last update: 2022-11-30 00:27:43

Author of last update: Jstuelk