ybeF

ybeF
168

unknown

locus
BSU_02150
Molecular weight
9.02 kDa
pI
7.89
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybeF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
235,625  235,873
The protein
Structure
[AF|O31442]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]-[gene|84BD1259552AAC6FBDE42221B42F57DEFF3622E8|ybfA]-[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]
description
[Pubmed|22383849]
Open in new tab

[gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]→[gene|93AEC802E8B9A6F8DBA0D55AE234A47B9B3858B3|ybfB]

2022-10-23 03:34:30

Jstuelk

7

1afc5a31aeaa2255359589aa12a176cd49ea7172

3F7981DE9DCD035C47FD3E3F5BD5AAFABA36FBEE

Biological materials
Mutant
MGNA-B973 (ybeF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1972 NBRP B. subtilis, Japan]
BKE02150 ([gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTAAACAGCCTCCCT,  downstream forward: _UP4_TAAAAAGACCTCACTTTCTA
BKK02150 ([gene|9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059|ybeF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02150 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTTAAACAGCCTCCCT,  downstream forward: _UP4_TAAAAAGACCTCACTTTCTA

9DA5DB1F98E7CC97F45F59EA8513BFA36EC36059

Page visits: 913

Time of last update: 2022-11-29 05:59:05

Author of last update: Melvin.boenninger