sspC

sspC
168

small acid-soluble spore protein (minor alpha/beta-type SASP)

locus
BSU_19950
Molecular weight
7.62 kDa
pI
9.1
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor alpha/beta-type SASP)
essential
no
synonyms
sspC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5852

This gene is a member of the following regulons

Gene
Coordinates
2,156,239  2,156,457
The protein
Protein family
[wiki|Alpha/beta-type SASP family] (according to UniProt)
Structure
[PDB|2Z3X] (in complex with DNA)
[AF|P02958]
Paralogous protein(s)
[protein|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD], [protein|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA], [protein|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB]
Expression and Regulation
Operons
genes
[gene|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC]
description
[Pubmed|2981806]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,2468649]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,2468649], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC]

2022-12-16 13:13:30

ghost

17

604a19bbfe57965113f8ddf9772b07212898c97a

5C68E83A498E2B21271D05450F39720723EB858F

Biological materials
Mutant
BKE19950 ([gene|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCATCTCCTAAA,  downstream forward: _UP4_TTAGCTCAACAAAACATGGGC
BKK19950 ([gene|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCATCTCCTAAA,  downstream forward: _UP4_TTAGCTCAACAAAACATGGGC
References
Reviews
35638784
Original Publications
14526021,11044450,11274127,15150240,8071212,12234173,9573155,2981806,2468649,18287075,15699190

9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA

Page visits: 2148

Time of last update: 2023-01-29 16:53:45

Author of last update: Jstuelk