frlO

frlO
168

aminosugar [wiki|ABC transporter] (binding protein)

locus
BSU_32600
Molecular weight
47.86 kDa
pI
5.67
Protein length
Gene length
function
uptake of sugar amines
product
aminosugar [wiki|ABC transporter] (binding protein)
essential
no
synonyms
frlO, yurO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1653

This gene is a member of the following regulons

Gene
Coordinates
3,349,761  3,351,029
The protein
Protein family
[wiki|Bacterial solute-binding protein 1 family] (according to UniProt)
Structure
[PDB|3ZKK] (from Bifidobacterium animalis, 26% identity) [pubmed|24279727]
[AF|O32156]
[wiki|Localization]
membrane associated (via [protein|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[protein|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]) [Pubmed|10092453,18763711]
Expression and Regulation
Operons
genes
[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP]
description
[Pubmed|23175651,21347729,22383849]
regulation
'' [protein|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]'': repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]) [Pubmed|12618455]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455], [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR]: repression, [Pubmed|21398478], in [regulon|protein:412A1DBBE7F87765DEBEEAAE02A047636A354D5E|frlR regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|ylxR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [pubmed|22383849], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
the [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP] operon is strongly downregulated in a [gene|search|cshA ]mutant [Pubmed|23175651]
Open in new tab

[gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]→[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|frlP]

2022-11-26 22:29:58

Jstuelk

35

1386d0b18bc93ba0b08e1c36531a0379aa199ac3

218EAE44649CE3CDE2633AF97E4CC56ABC5AA2E3

Biological materials
Mutant
MGNA-A561 (yurO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/561 NBRP B. subtilis, Japan]
BKE32600 ([gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTGGCCTCCTCTG,  downstream forward: _UP4_TAAATCAAAGAAAAGGTGAA
BKK32600 ([gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTGGCCTCCTCTG,  downstream forward: _UP4_TAAATCAAAGAAAAGGTGAA
References
23175651,21815947,12618455,10092453,21347729,18763711,21398478,24279727

9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B

Page visits: 2609

Time of last update: 2022-11-28 22:17:40

Author of last update: Jstuelk