ykoH

ykoH
168

two-component sensor kinase

locus
BSU_13260
Molecular weight
50.49 kDa
pI
6.17
Protein length
Gene length
function
unknown
product
two-component sensor kinase
essential
no
synonyms
ykoH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0642

This gene is a member of the following regulons

Gene
Coordinates
1,392,643  1,394,007
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
two transmembrane segments
[wiki|HAMP domain] (aa 176-230) (according to UniProt)
[wiki|Histidine kinase domain] (aa 238-450) (according to UniProt)
Structure
[PDB|5C93] (Lactobacillus plantarum [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|walK], corresponds to aa 230 ... 441, 32% identity) [pubmed|28994408]
[AF|O34638]
Modification
autophosphorylation on a His residue
Paralogous protein(s)
[protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE], [protein|4EE48E4931F662E51586DB6D01E91C688329222D|cssS], [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|yclK], [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG]-[gene|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH]-[gene|0678357183072D2716B913C07103CEBF65E60D14|ykoI]-[gene|348EAFC260435B3E0ED3CC7BC27EBA8DCFCBBEDC|ykoJ]
description
[Pubmed|22383849]
Open in new tab

[gene|6A37531896205A9B894C81AB0563C216C0B52CD7|ykoG]→[gene|348EAFC260435B3E0ED3CC7BC27EBA8DCFCBBEDC|ykoJ]

2022-11-23 16:17:25

Jstuelk

18

94c4f5ed861eb90d409ae60d8f15a7e83defa9a9

4CE73C876804A253735805E36E7F7CBF728FACD6

Biological materials
Mutant
MGNA-B312 (ykoH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1311 NBRP B. subtilis, Japan]
BKE13260 ([gene|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCTTGGTCTTCAGCTTCA,  downstream forward: _UP4_AGCGAACAGAATGGGGGAGG
BKK13260 ([gene|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCTTGGTCTTCAGCTTCA,  downstream forward: _UP4_AGCGAACAGAATGGGGGAGG
References
10094672,28994408

9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B

Page visits: 1302

Time of last update: 2022-11-27 07:08:06

Author of last update: Melvin.boenninger