dppA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

dppA
168

D-alanyl-aminopeptidase

locus
BSU_12920
Molecular weight
30.09 kDa
pI
5.19
Protein length
Gene length
function
degradation of cell wall peptides
product
D-alanyl-aminopeptidase
essential
no
ec
null
synonyms
dppA, dciAA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2362

This gene is a member of the following regulons

Gene
Coordinates
1,360,401  1,361,225
The protein
Protein family
peptidase M55 family (single member, according to UniProt)
Structure
[PDB|1HI9]
[AF|P26902]
Modification
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
Expression and Regulation
Operons
genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]
description
[Pubmed|1766371]
regulation
repressed by glucose (2.9-fold) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|7783641], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1766371], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]→[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]

2022-02-24 01:12:30

Jstuelk

11

09ee4083370400f9df0298a2b88ab5c0bbf1df43

5AB4A35A00613327500FE4CC530C2BFA97A6C07B

genes
[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
description
[pubmed|22383849]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]->[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]

2022-04-28 09:17:33

Bzhu

20

9978370314fc05087eca13c4f3ce94e92ce93ff2

E2A0CC9BE866DBD9F0E3A5F48EE05465C14EFD9D

Biological materials
Mutant
BKE12920 ([gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGCTCCTCCTTTTTT,  downstream forward: _UP4_TTCTGCTAAAGGGGTGTTTT
BKK12920 ([gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACGCTCCTCCTTTTTT,  downstream forward: _UP4_TTCTGCTAAAGGGGTGTTTT
References
18083814,12618455,1766371,19602397,7783641,1766371,12850135,16493705

9E922F0006DF9E84A8D5B51E9FC35B669872FF90

Page visits: 2077

Time of last update: 2022-05-19 17:28:52

Author of last update: Melvin.boenninger