yxkF

yxkF
168

unknown

locus
BSU_38820
Molecular weight
34.67 kDa
pI
5.33
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yxkF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2508

This gene is a member of the following regulons

Gene
Coordinates
3,985,351  3,986,244
The protein
Structure
[AF|P94359]
Expression and Regulation
Operons
genes
[gene|9EE268C3DC3C0F2F846DAEB2004222B6F841B9EA|yxkF]-[gene|434F6C546F783503A82D390FD238F05025FC1802|msmX]
description
[Pubmed|10746760]
regulation
repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|10666464]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|9EE268C3DC3C0F2F846DAEB2004222B6F841B9EA|yxkF]→[gene|434F6C546F783503A82D390FD238F05025FC1802|msmX]

2022-05-08 08:10:55

Jstuelk

13

AF2FCB62C3853F05544C97E9ABCDF316421AD12D

84C66B43C7822D0A3BB4809B557110959136271B

Biological materials
Mutant
MGNA-B740 (yxkF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1739 NBRP B. subtilis, Japan]
GP1117 (spc), available in [wiki|Jörg Stülke]'s lab
BKE38820 ([gene|9EE268C3DC3C0F2F846DAEB2004222B6F841B9EA|yxkF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAGTCTCCTCTCTTAT,  downstream forward: _UP4_TAAATTGGAAATATGCACGA
BKK38820 ([gene|9EE268C3DC3C0F2F846DAEB2004222B6F841B9EA|yxkF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38820 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAGTCTCCTCTCTTAT,  downstream forward: _UP4_TAAATTGGAAATATGCACGA
References
16672620

9EE268C3DC3C0F2F846DAEB2004222B6F841B9EA

Page visits: 935

Time of last update: 2022-10-06 03:48:41

Author of last update: Jstuelk