opcR

opcR
168

transcriptional repressor of the [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] and [gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD] operons

locus
BSU_33840
Molecular weight
21.61 kDa
pI
5.84
Protein length
Gene length
function
regulation of choline uptake
product
transcription repressor
essential
no
synonyms
opcR, yvbF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1510

This gene is a member of the following regulons

Gene
Coordinates
3,471,266  3,471,823
The protein
Catalyzed reaction/ biological activity
transcriptional repression of the ''[gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]'' and ''[gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]'' operons [Pubmed|23960087]
Protein family
GbsR family (with [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|gbsR] and [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV], according to UniProt)
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 28-79) (according to InterPro)
Structure
[AF|O34709]
Paralogous protein(s)
[protein|4D288C63F68A9A4B39535D849D455B49F4E65050|yvaV]
Expression and Regulation
Operons
genes
[gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]
description
[Pubmed|22383849]
Open in new tab

[gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]

2022-11-26 04:01:48

Jstuelk

15

5fe58ac26e7788b7a2efd5a386983777370a4610

9FD54C4D39C054EF552359C92C9459DA7C031A80

Biological materials
Mutant
MGNA-A458 (yvbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/458 NBRP B. subtilis, Japan]
BKE33840 ([gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGCTGATCATCCCTTCA,  downstream forward: _UP4_AAATAAGAGAGCTGCTTTTT
BKK33840 ([gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33840 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGCTGATCATCCCTTCA,  downstream forward: _UP4_AAATAAGAGAGCTGCTTTTT
References
23960087,32849357

9F32E96AC9C32832C2F10FB125DDDC50EC9B546B

Page visits: 1699

Time of last update: 2022-12-02 15:43:59

Author of last update: Jstuelk