yvdQ

yvdQ
168

putative spore coat protein

locus
BSU_34510
Molecular weight
18.44 kDa
pI
5.81
Protein length
Gene length
function
protection of the spore
product
putative spore coat protein
essential
no
synonyms
yvdQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,542,179  3,542,691
The protein
Structure
[PDB|2RBD] (from B. halodurans, 57% identity)
[AF|O06998]
Expression and Regulation
Operons
genes
[gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
[protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
Open in new tab

[gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]

2023-01-28 07:42:41

ghost

16

75802302b2837531d8b127905611813a3968b373

7D5164A62C7AA18F7031A5947806753DD6A47E84

Biological materials
Mutant
MGNA-B619 (yvdQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1618 NBRP B. subtilis, Japan]
BKE34510 ([gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCTCCTCCCAT,  downstream forward: _UP4_TAATGGCAAAGGCATATACA
BKK34510 ([gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34510 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCTCCTCCCAT,  downstream forward: _UP4_TAATGGCAAAGGCATATACA
References
16497325

A0392469FB5B36C030C003ECC0EC39F71BBC5CD0

Page visits: 931

Time of last update: 2023-02-06 04:09:11

Author of last update: Bzhu