yozK

yozK
168

N-terminal fragment of the Y family DNA polymerase [protein|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]-[protein|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]

locus
BSU_18940
Molecular weight
12.84 kDa
pI
8.2
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yozK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Phenotypes of a mutant
reduced formation of [gene|F1969E4C7BAAF70BCBE570F58350C12A3E417539|rpsB] or [gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE] suppressor mutants after mitomycin treatment [pubmed|34339280]
The protein
Protein family
[wiki|DNA polymerase type-Y family] (according to UniProt)
[wiki|Domains]
[wiki|UmuC domain] (aa 12-115) (according to UniProt)
Structure
[AF|O31841]
Expression and Regulation
Operons
genes
[gene|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL]-[gene|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]-[gene|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]
description
[Pubmed|16267290]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
Open in new tab

[gene|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|yozL]→[gene|ED0A85A8A5FCD12C99507EB033F88586521A7C47|yobH]

2022-11-22 11:58:12

ghost

22

6652ba898aede72e843253b4ec86dfa073d4364f

144FEA12BA8DE72B8E183E729FD09DD9387803D2

Biological materials
Mutant
MGNA-B409 (yozK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1408 NBRP B. subtilis, Japan]
BKE18940 ([gene|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCTCACGTGGAAATTGTG,  downstream forward: _UP4_TAATCTTTTTTAGATGCAGG
BKK18940 ([gene|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCTCACGTGGAAATTGTG,  downstream forward: _UP4_TAATCTTTTTTAGATGCAGG
References
16267290,27766092,30916324,34339280

A04F698C8836E84991BC875BCB7B1460D8E74A8E

Page visits: 1880

Time of last update: 2022-12-03 21:47:51

Author of last update: Jstuelk