SubtiWiki SubtiWiki
mhqN

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

mhqN
168

similar to NAD(P)H nitroreductase

locus
BSU_05480
Molecular weight
23.41 kDa
pI
5.56
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
mhqN, ydfN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0778

This gene is a member of the following regulons

Gene
Coordinates
596,478  597,098
The protein
Protein family
[wiki|nitroreductase family] (according to UniProt)
Structure
[PDB|3BEM]
Expression and Regulation
Operons
genes
[gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]-[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]
description
[Pubmed|17725564]
regulation
induced by catechol and 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
regulatory mechanism
[protein|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]: repression, [Pubmed|17725564], in [regulon|protein:997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725564], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]→[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]

2022-01-04 21:16:01

ghost

12

861c2755cb55e0bfdad6bb1ace7ebeb4dc8b648a

4CB4BE4DEF7D53B85280E482DDD12220874522FA

Biological materials
Mutant
MGNA-C153 (ydfN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2151 NBRP B. subtilis, Japan]
BKE05480 ([gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTACACTCCCTTT,  downstream forward: _UP4_TATATGTAAAAGGAGCGGAT
BKK05480 ([gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTACACTCCCTTT,  downstream forward: _UP4_TATATGTAAAAGGAGCGGAT
lacZ fusion
BP1112: Promotor-lacZ fusion, available at [wiki|Jörg Stülke]'s and [wiki|Fabian Commichau]'s labs
References
17407181,17725564,27965289

A0842DD5F1B13AC15C95F18751E7836DF31B262A

Page visits: 1139

Time of last update: 2021-12-23 18:04:40

Author of last update: Melvin.boenninger