srtN

srtN
168

protein deacetylase and lipoamidase

locus
BSU_09650
Molecular weight
27.27 kDa
pI
5.13
Protein length
Gene length
function
control of [protein|search|AcsA ]activity
product
NAD(+)-dependent deacetylase and lipoamidase
essential
no
synonyms
srtN, yhdZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0846

This gene is a member of the following regulons

Gene
Coordinates
1,040,094  1,040,837
Phenotypes of a mutant
increased 2-oxoglutarate dehydrogenase activity [pubmed|28900027]
The protein
Catalyzed reaction/ biological activity
H2O + N6-acetyl-L-lysyl-[protein] + NAD+ --> 2''-O-acetyl-ADP-D-ribose + L-lysyl-[protein] + nicotinamide (according to UniProt)
deacetylates (and thereby activates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA] (together with [protein|1255813797A83D835E0656A2AAAD361B5BB2094B|acuC]) [Pubmed|19136592]
removes lipoic acid from E2 subunits of ketoacid dehydrogenases and from the H protein of the glycine cleavage system [pubmed|28900027]
Protein family
sirtuin family (single member, according to UniProt)
[wiki|Domains]
Deacetylase sirtuin-type domain (aa 2-247) (according to UniProt)
Structure
[PDB|1MA3] (from ''Archaeoglobus fulgidus'', 40% identity) [Pubmed|12408821]
[AF|O07595]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]
description
[Pubmed|22383849]
Open in new tab

[gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]

2022-11-25 03:52:27

Jstuelk

17

30880a48897d707c124222775226c50c7f79f3e3

E6861320780F3842D35EACA562232A7CAFCC92CA

Biological materials
Mutant
MGNA-B488 (yhdZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1487 NBRP B. subtilis, Japan]
GP1210 (''[gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]''::''cat''), available in [wiki|Jörg Stülke]'s lab
1A888 ( ''srtN''::''spec''), [Pubmed|19136592], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A888&Search=1A888 BGSC]
BKE09650 ([gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTCAACACCGCCTTTTT,  downstream forward: _UP4_TGAGCCGCTTTATGCGCCTC
BKK09650 ([gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09650 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACTCAACACCGCCTTTTT,  downstream forward: _UP4_TGAGCCGCTTTATGCGCCTC
References
19136592,26708127,12408821,26098117,28900027

A0A6CB19191A251BB5600C18E039978A9A34933C

Page visits: 2698

Time of last update: 2022-12-06 04:20:14

Author of last update: Melvin.boenninger