

succinate-semialdehyde dehydrogenase (NADP), general stress protein

Molecular weight
50.10 kDa
Protein length
Gene length
utilization of gamma-amino butyric acid
succinate-semialdehyde dehydrogenase (NADP)
gabD, ycnH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1012

This gene is a member of the following regulons

442,950  444,338
Phenotypes of a mutant
growth defect in the presence of gamma-aminobutyrate  [Pubmed|24127574]
The protein
Catalyzed reaction/ biological activity
H2O + NADP+ + succinate semialdehyde --> 2 H+ + NADPH + succinate (according to UniProt)
Protein family
[wiki|aldehyde dehydrogenase family] (according to UniProt)
[PDB|3RHH] (from from ''Bacillus halodurans'' C-125 complexed with NADP, 36% identity, 68% similarity)
Paralogous protein(s)
[protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|yfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|aldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|aldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|ywdH]
Expression and Regulation
''[protein|search|gabD]'': induced by stress ([protein|search|SigB]) [Pubmed|15805528]
regulatory mechanism
[protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]: activation, [Pubmed|12123465], in [regulon|protein:C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12123465], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab


2022-11-29 00:18:42





''[protein|search|gabD]'': induced by stress ([protein|search|SigB]) [Pubmed|15805528]
regulatory mechanism
[protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR]: activation, [Pubmed|32147931,12123465], in [regulon|protein:C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12123465], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2022-11-24 21:46:38





Biological materials
MGNA-C015 (ycnH::erm), available at the [ NBRP B. subtilis, Japan]
BKE03910 ([gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGAACATTCCTTTCT,  downstream forward: _UP4_TAAAAGAATGCACGCTCCTG
BKK03910 ([gene|A0BEB92D54799956A4ADE106A1388E5710141069|gabD]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGAACATTCCTTTCT,  downstream forward: _UP4_TAAAAGAATGCACGCTCCTG
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [ Homepage]


Page visits: 3669

Time of last update: 2022-12-06 04:23:34

Author of last update: Melvin.boenninger