ldh

ldh
168

L-lactate dehydrogenase

locus
BSU_03050
Molecular weight
34.00 kDa
pI
5.394
Protein length
Gene length
function
overflow metabolism, fermentation
product
L-lactate dehydrogenase
essential
no
ec
1.1.1.27
synonyms
ldh, lctE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0039

This gene is a member of the following regulons

Gene
Coordinates
329,774  330,739
The protein
Catalyzed reaction/ biological activity
(S)-lactate + NAD+ --> H+ + NADH + pyruvate (according to UniProt)
Protein family
LDH/MDH superfamily (with [protein|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh], according to UniProt)
Structure
[PDB|3PQE]
[PDB|A general discussion of Ldh structure]
[AF|P13714]
Modification
phosphorylation on Tyr-224 [Pubmed|17218307]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]-[gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]
description
[Pubmed|16207915]
regulation
induced under anaerobic conditions ([protein|search|Rex]) [Pubmed|16207915]
regulatory mechanism
[protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]: repression, [Pubmed|16207915], in [regulon|protein:B5EF521437323EF43F08E5EFDB5C798616CA499A|rex regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10809684], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]→[gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]

2022-11-26 10:15:55

ghost

41

4e780837233d2e8aaeda4442db171cadf439e394

20AF87A98A20E424287B9BFAEFDE8827032D1500

Biological materials
Mutant
BKE03050 ([gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATCCTTCCAGGG,  downstream forward: _UP4_TAACCGCAACTTTAGAGTAA
BKK03050 ([gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATCCTTCCAGGG,  downstream forward: _UP4_TAACCGCAACTTTAGAGTAA
GP2597 ([gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]::tet comIQ12L) (in DK1042) available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP3326 (cat, based on [wiki|pAC5]]), available in [wiki|Jörg Stülke]'s lab
References
17586670,16207915,16207915,17218307,22862776,34537531,34627250

A0DD68FE90FD13DF03496321AB2DAAADF9F4230D

Page visits: 4785

Time of last update: 2022-11-27 04:16:29

Author of last update: Jstuelk