tepA

tepA
168

orphan [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP]-like [wiki|germination] protease, contributes to SASP degradation

locus
BSU_16790
Molecular weight
24.10 kDa
pI
5.57
Protein length
Gene length
function
degradation of SASPs
product
[wiki|germination] protease
essential
no
synonyms
tepA, ymfB, ylxI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0740

This gene is a member of the following regulons

Gene
Coordinates
1,751,201  1,751,938
The protein
Catalyzed reaction/ biological activity
degradation of SASPs in germinating spores [Pubmed|23927687]
Protein family
Peptidase S14 family (with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP], according to UniProt)
Structure
[AF|Q99171]
Effectors of protein activity
activity requires [protein|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ] [Pubmed|23927687]
[wiki|Localization]
inner spore membrane [Pubmed|26731423]
Expression and Regulation
Operons
genes
[gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]-[gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]
description
[Pubmed|22383849]
regulation
expressed late during [wiki|sporulation] in the forespore ([protein|search|SigG], [wiki|SpoVT]) [Pubmed|23123912]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: repression, [Pubmed|23123912], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|23123912], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]→[gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]

2023-01-18 18:26:18

ghost

29

881067a6f0a1afd8c17c21d46442823bbbcc221d

65C3CDB44DB233763F0B479582509A5F32BD4D75

Biological materials
Mutant
MGNA-B377 (ymfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1376 NBRP B. subtilis, Japan]
GP1120 (spc), available in [wiki|Jörg Stülke]'s lab
BKE16790 ([gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCGCTTTCATCCTTTC,  downstream forward: _UP4_AAAGAAGAAGGACGGATGAT
BKK16790 ([gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16790 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTCGCTTTCATCCTTTC,  downstream forward: _UP4_AAAGAAGAAGGACGGATGAT
References
Reviews
35638784
Original Publications
23123912,22383849,10455123,23927687,26731423

A16C6515D185E3A268D57D77F28EF7EF9AF9FE05

Page visits: 2002

Time of last update: 2023-02-02 20:02:13

Author of last update: Jstuelk