mhqE

mhqE
168

dioxygenase/glyoxalase

locus
BSU_19570
Molecular weight
33.70 kDa
pI
5.04
Protein length
Gene length
function
resistance to methyl hydroquinone and catechol
product
dioxygenase/glyoxalase
essential
no
ec
null
synonyms
mhqE, yodE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0346

This gene is a member of the following regulons

Gene
Coordinates
2,129,082  2,129,993
The protein
Protein family
[wiki|extradiol ring-cleavage dioxygenase family] (according to UniProt)
[wiki|Domains]
2 [wiki|VOC domain]s (aa 5-129, aa 150-266) (according to UniProt)
Structure
[PDB|3OAJ] ([protein|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO], 48% identical residues)
[AF|O34543]
Paralogous protein(s)
[protein|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO], [protein|7334017333600B876030056BE9247AD4E8996A1D|mhqA]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]-[gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]
description
[Pubmed|17725564]
regulation
induced by 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
regulatory mechanism
[protein|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]: repression, [Pubmed|17725564], in [regulon|protein:997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|17725564], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]→[gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]

2022-06-12 21:21:26

ghost

10

c73bcc0fe564b49697d45cf6339f78a16f9599db

EF7D4F8AD102932E1FD3C87A8572EA7A1ED0F78B

Biological materials
Mutant
MGNA-B436 (yodE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1435 NBRP B. subtilis, Japan]
BKE19570 ([gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCACTCCTATTTA,  downstream forward: _UP4_GAACTTTAAAAGGGGGAATT
BKK19570 ([gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCACTCCTATTTA,  downstream forward: _UP4_GAACTTTAAAAGGGGGAATT
References
17407181,17725564

A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208

Page visits: 659

Time of last update: 2022-06-25 10:49:17

Author of last update: Melvin.boenninger