SubtiWiki SubtiWiki
yozP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yozP
168

unknown

locus
BSU_21310
Molecular weight
12.22 kDa
pI
4.94
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yozP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,246,151  2,246,480
Biological materials
Mutant
BKE21310 ([gene|A1FBB09FDD78D541F799940CC37C27CB8EC51F27|yozP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGATATCTCCTCCAATTG,  downstream forward: _UP4_GGATGTATTTGTGGTGCTTA
BKK21310 ([gene|A1FBB09FDD78D541F799940CC37C27CB8EC51F27|yozP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGATATCTCCTCCAATTG,  downstream forward: _UP4_GGATGTATTTGTGGTGCTTA

A1FBB09FDD78D541F799940CC37C27CB8EC51F27

Page visits: 742

Time of last update: 2022-01-26 12:51:25

Author of last update: Jstuelk