rapI

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

rapI
168

response regulator aspartate phosphatase, antagonist of [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]

locus
BSU_05010
Molecular weight
46.40 kDa
pI
5.05
Protein length
Gene length
function
control of transfer of the mobile genetic element ICEBs1
product
response regulator aspartate phosphatase
essential
no
synonyms
rapI, yddL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
547,306  548,481
The protein
Catalyzed reaction/ biological activity
binds ImmR and inhibits its activity, this results in induction of the genes for the transfer of the mobile genetic element ICEBs1 [Pubmed|17511812]
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[PDB|4I1A] [Pubmed|23526881]
[AF|P96649]
Effectors of protein activity
binding of [protein|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI] indicates that neighbour cells do already contain the genetic element ICEBs1, this results in inactivation of RapI [Pubmed|17511812]
Expression and Regulation
Operons
genes
[gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]-[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]
description
[Pubmed|11466295]
regulation
induced at high cell density ([wiki|ComA]) [Pubmed|26582911]
regulatory mechanism
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, [Pubmed|26582911], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
sigma factors
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|11466295], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11466295], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]→[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]

2022-04-27 13:41:53

ghost

17

c6bf4c9c966d856b996319a23cd84edf50ae9036

4330041E5A91F89C1F761867ABD13572DFB6F31C

Biological materials
Mutant
BKE05010 ([gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATTCCCCCATCCT,  downstream forward: _UP4_TTGATGAAAATCAGCCGGAT
BKK05010 ([gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATTCCCCCATCCT,  downstream forward: _UP4_TTGATGAAAATCAGCCGGAT
References
Reviews
24995588
Original Publications
11466295,17511812,23526881,26582911

A208B4564A50D7BE2630DE40E8FAAF3C16236EE4

Page visits: 5352

Time of last update: 2022-05-19 05:00:04

Author of last update: Melvin.boenninger