SubtiWiki SubtiWiki
ynzD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ynzD
168

Spo0A-P phosphatase, control of the phosphorelay

locus
BSU_17920
Molecular weight
6.55 kDa
pI
6.33
Protein length
Gene length
function
control of sporulation initiation
product
Spo0A-P phosphatase
essential
no
ec
null
synonyms
ynzD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5804

This gene is a member of the following regulons

Gene
Coordinates
1,922,841  1,923,014
The protein
Protein family
spo0E family (with [protein|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]and [protein|A574974B6F4FF46DC69E03AE021651C67089866F|spo0E], according to UniProt)
Paralogous protein(s)
[protein|A574974B6F4FF46DC69E03AE021651C67089866F|spo0E]
Expression and Regulation
Operons
genes
[gene|A2250786C40A23A5EBD830B3853DE5187B3D24EC|ynzD]
description
[Pubmed|9068642]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|A2250786C40A23A5EBD830B3853DE5187B3D24EC|ynzD]

2021-12-05 21:41:14

ghost

5

c35a25664bd1dd158145cf777b66f7e8e5a09717

05219C36206042AD2A59EBE8132CD9B48033E0F7

Biological materials
Mutant
BKE17920 ([gene|A2250786C40A23A5EBD830B3853DE5187B3D24EC|ynzD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGGGATGTATCCTTTCA,  downstream forward: _UP4_TGATTGCAAAATAAAAAACC
BKK17920 ([gene|A2250786C40A23A5EBD830B3853DE5187B3D24EC|ynzD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17920 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGGGATGTATCCTTTCA,  downstream forward: _UP4_TGATTGCAAAATAAAAAACC
References
9068642,11679073,20817675

A2250786C40A23A5EBD830B3853DE5187B3D24EC

Page visits: 1159

Time of last update: 2022-01-16 20:18:46

Author of last update: Melvin.boenninger