yoaV

yoaV
168

putative cysteine and O-acetyl serine efflux permease

locus
BSU_18770
Molecular weight
32.89 kDa
pI
9.43
Protein length
Gene length
function
unknown
product
putative cysteine and O-acetyl serine efflux permease
essential
no
ec
null
synonyms
yoaV, cyeA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
2,045,929  2,046,807
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 13-137, aa 159-285) (according to UniProt)
Structure
[AF|O34416]
Expression and Regulation
Operons
genes
[gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]-[gene|10484E5BB5DC0117CDE97036AF82F04F07926AEF|yozG]-[gene|694BC1E02DBAC48CC2BEEFCADED7889BC18E363C|yoaT]-[gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]
description
[Pubmed|22383849]
Open in new tab

[gene|E2F9D7C9BC9166AD462E0017F50BDD9ECF9C6835|yoaS]→[gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]

2022-12-09 08:55:54

Jstuelk

17

e1fec5fcebca74a6826ba267402f908730f829be

BF360B1892DEF31A985ABEAF23F1E479299F80FB

Biological materials
Mutant
MGNA-B401 (yoaV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1400 NBRP B. subtilis, Japan]
BKE18770 ([gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGAAGCCGCCTTTCT,  downstream forward: _UP4_TGAATGATATACATTTCCCC
BKK18770 ([gene|A23D34C5D38A48144B062C3BAF9BDF38CEA1207F|yoaV]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGAAGCCGCCTTTCT,  downstream forward: _UP4_TGAATGATATACATTTCCCC

A23D34C5D38A48144B062C3BAF9BDF38CEA1207F

Page visits: 764

Time of last update: 2023-01-23 09:00:15

Author of last update: Melvin.boenninger