ykuJ

ykuJ
168

unknown

locus
BSU_14100
Molecular weight
9.11 kDa
pI
4.34
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykuJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4703

This gene is a member of the following regulons

Gene
Coordinates
1,484,117  1,484,356
The protein
Structure
[PDB|2FFG]
[AF|O34588]
Expression and Regulation
Operons
genes
[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]-[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]
description
[Pubmed|16395550]
regulation
expressed under conditions that trigger sporulation ([wiki|Spo0A]) [Pubmed|14651647]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, by [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]~P [Pubmed|18840696,14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|16395550,12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
Open in new tab

[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]→[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]

2023-01-30 22:40:21

ghost

58

c31a71bd4220fdbe189c19124eb835899db4473b

DE202F49BDBFA88FBD49A4685EB1CB8595CFCE08

Biological materials
Mutant
MGNA-A771 (ykuJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/771 NBRP B. subtilis, Japan]
GP214 (deletion of ''[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]'', replaced by ''aphA3''), available in [wiki|Jörg Stülke]'s lab
BKE14100 ([gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAAAAAGACTCCT,  downstream forward: _UP4_TAAGATTCCTGAAATAGGGG
BKK14100 ([gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAAAAAGACTCCT,  downstream forward: _UP4_TAAGATTCCTGAAATAGGGG
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP710 (in [wiki|pAC5]), available in [wiki|Jörg Stülke]'s lab, pGP714 (in [wiki|pAC6]), available in [wiki|Jörg Stülke]'s lab
References
16395550

A26502ADAC214D45A8F7F394587B0BDFBE7AF28E

Page visits: 1434

Time of last update: 2023-02-02 03:29:09

Author of last update: Rica