ktrB
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

ktrB
168

high affinity potassium channel [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB], integral membrane subunit

locus
BSU_31100
Molecular weight
48.27 kDa
pI
10.12
Protein length
Gene length
function
potassium uptake
product
high affinity potassium channel [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB], integral membrane subunit
essential
no
synonyms
ktrB, yubG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0168

This gene is a member of the following regulons

Gene
Coordinates
3,189,089  3,190,426
Phenotypes of a mutant
a [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA] [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA] [gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source [pubmed|28420751,28679749]
inactivation of [gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] facilitates the adaptation a strain lacking c-di-AMP to growth on medium containing glutamate [pubmed|33481774]
a [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA] [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] double mutant is unable to adapt to the presence of 1.2 M NaCl [pubmed|35164567]
The protein
Catalyzed reaction/ biological activity
uptake of potassium
Protein family
TrkH potassium transport family (with [protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD], according to UniProt)
Structure
[PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] complex) [Pubmed|23598340]
[AF|O32081]
Kinetic information
the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] channel has a high affinity for potassium,this is determined by [protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] [pubmed|30753894]
Paralogous protein(s)
[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD]
Expression and Regulation
Operons
genes
[gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]
description
[Pubmed|12562800]
regulatory mechanism
c-di-AMP Riboswitch: termination/antitermination, expression is switched off upon binding of c-di-AMP, in [regulon|other_regulator:c-di-AMP Riboswitch|c-di-AMP Riboswitch]
Open in new tab

[gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]→[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]

2022-07-13 00:41:00

ghost

29

26a6fe341a783d36d890ffc444805dfdfe1546b2

0D50A42396785200FADF8E4BEF6B3A6058277227

additional information
growth at extreme potassium limitation results in the acquisition of promoter mutations with increased [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] expression [pubmed|28679749]
Biological materials
Mutant
MGNA-A227 (yubG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/227 NBRP B. subtilis, Japan]
1A954 ( ''ktrB''::''kan''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A954&Search=1A954 BGSC]
GHB1 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [wiki|Erhard Bremer]'s lab
GP92 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP2083 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3'' [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP2498 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc'' [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::''cat''), available in [wiki|Jörg Stülke]'s lab
BKE31100 ([gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTTTGTCTACATCCCTT,  downstream forward: _UP4_TGATATCAAAAAAATCCGGC
BKK31100 ([gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCTTTGTCTACATCCCTT,  downstream forward: _UP4_TGATATCAAAAAAATCCGGC
GP2716 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc''), available in [wiki|Jörg Stülke]'s lab [pubmed|32253343]
GP3064 ([gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''kan''), available in [wiki|Jörg Stülke]'s lab [pubmed|32253343]
Expression vectors
pGP2992 (N-terminal 6xHis-tag, purification from E. coli, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP2277 (based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab [pubmed|28679749]
labs
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
[wiki|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]
[wiki|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
25869574,21680052,27935846,25838295,28825218,33798529,33288383
Original Publications
12562800,20511502,17932047,23086297,23598340,16990138,24141192,26771197,28420751,28504641,28679749,30753894,31624134,32253343,33481774,33732218,35164567

A287B9771A56D03ADCA603C1969CBF03DCB10E95

Page visits: 2493

Time of last update: 2022-08-07 18:31:33

Author of last update: Jstuelk