bofC

bofC
168

general stress protein, controls processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] by [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]

locus
BSU_27750
Molecular weight
19.15 kDa
pI
5.75
Protein length
Gene length
function
control of processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] by [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]
product
forespore regulator of the [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] checkpoint
essential
no
ec
null
synonyms
bofC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5849

This gene is a member of the following regulons

Gene
Coordinates
2,836,909  2,837,421
The protein
Structure
[PDB|2BW2]
[AF|O05391]
Expression and Regulation
Operons
genes
[gene|12B260DBC4E29151364251837FD227593D0BF391|csbX]-[gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]
description
[Pubmed|9099855]
regulation
expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|16497325,9099855]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|22900538], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190,9099855], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|9099855], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,9099855], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|12B260DBC4E29151364251837FD227593D0BF391|csbX]→[gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]

2022-12-29 17:31:10

ghost

24

afb287c157dfce05e2528e7ea6aede7eb7492bfa

94466CFB0D27D00988F36AF9FE472181F7585610

Biological materials
Mutant
BKE27750 ([gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE27750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCCTCTACACCTCTTTGC,  downstream forward: _UP4_TAGCGTCCGCTGATTGAAGA
BKK27750 ([gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK27750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACCCTCTACACCTCTTTGC,  downstream forward: _UP4_TAGCGTCCGCTGATTGAAGA
References
Reviews
31350897,33538382
Original Publications
16497325,10931291,16049010,9025289,11544224,9099855

A2C94BB9272407B305B90151F77835BB90414D0F

Page visits: 2357

Time of last update: 2023-02-04 17:18:08

Author of last update: Jstuelk